
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-4c2.6
- Ensembl ID:
- ENSDARG00000088539
- ZFIN ID:
- ZDB-GENE-050411-41
- Human Orthologues:
- CNFN, PLAC8L1
- Human Descriptions:
- cornifelin [Source:HGNC Symbol;Acc:30183]
- PLAC8-like 1 [Source:HGNC Symbol;Acc:31746]
- Mouse Orthologues:
- Cnfn, Plac8l1
- Mouse Descriptions:
- cornifelin Gene [Source:MGI Symbol;Acc:MGI:1919633]
- PLAC8-like 1 Gene [Source:MGI Symbol;Acc:MGI:1916651]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa45405 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa45405
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000127025 | Nonsense | 108 | 129 | 3 | 3 |
ENSDART00000133374 | Nonsense | 108 | 129 | 4 | 4 |
- Genomic Location (Zv9):
- Chromosome 10 (position 22324687)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 22155025 GRCz11 10 22124477 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATGTGTAATGACTGTGTGTTGTCCACATTCTGCAGACCCTGTGTTTGGTG[T/A]CAAATGTCCAGAGAAATGAAAGAACGGGATTTACAAATTGCTCTTATTCG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: