si:dkey-4c2.6

Ensembl ID:
ENSDARG00000088539
ZFIN ID:
ZDB-GENE-050411-41
Human Orthologues:
CNFN, PLAC8L1
Human Descriptions:
cornifelin [Source:HGNC Symbol;Acc:30183]
PLAC8-like 1 [Source:HGNC Symbol;Acc:31746]
Mouse Orthologues:
Cnfn, Plac8l1
Mouse Descriptions:
cornifelin Gene [Source:MGI Symbol;Acc:MGI:1919633]
PLAC8-like 1 Gene [Source:MGI Symbol;Acc:MGI:1916651]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45405 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45405
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127025 Nonsense 108 129 3 3
ENSDART00000133374 Nonsense 108 129 4 4
Genomic Location (Zv9):
Chromosome 10 (position 22324687)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 22155025
GRCz11 10 22124477
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTGTAATGACTGTGTGTTGTCCACATTCTGCAGACCCTGTGTTTGGTG[T/A]CAAATGTCCAGAGAAATGAAAGAACGGGATTTACAAATTGCTCTTATTCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link