zgc:77651

Ensembl ID:
ENSDARG00000088524
ZFIN ID:
ZDB-GENE-040426-2381
Description:
peroxisomal acyl-CoA thioesterase-like [Source:RefSeq peptide;Acc:NP_998412]
Human Orthologues:
ACOT1, ACOT2, ACOT4, ACOT6, BAAT
Human Descriptions:
acyl-CoA thioesterase 1 [Source:HGNC Symbol;Acc:33128]
acyl-CoA thioesterase 2 [Source:HGNC Symbol;Acc:18431]
acyl-CoA thioesterase 4 [Source:HGNC Symbol;Acc:19748]
acyl-CoA thioesterase 6 [Source:HGNC Symbol;Acc:33159]
bile acid CoA: amino acid N-acyltransferase (glycine N-choloyltransferase) [Source:HGNC Symbol;Acc:9
Mouse Orthologues:
Acnat1, Acnat2, Acot1, Acot2, Acot3, Acot4, Acot5, Acot6, Baat
Mouse Descriptions:
acyl-CoA thioesterase 1 Gene [Source:MGI Symbol;Acc:MGI:1349396]
acyl-CoA thioesterase 2 Gene [Source:MGI Symbol;Acc:MGI:2159605]
acyl-CoA thioesterase 3 Gene [Source:MGI Symbol;Acc:MGI:2159619]
acyl-CoA thioesterase 4 Gene [Source:MGI Symbol;Acc:MGI:2159621]
acyl-CoA thioesterase 5 Gene [Source:MGI Symbol;Acc:MGI:2384969]
acyl-CoA thioesterase 6 Gene [Source:MGI Symbol;Acc:MGI:1921287]
acyl-coenzyme A amino acid N-acyltransferase 1 Gene [Source:MGI Symbol;Acc:MGI:2140197]
acyl-coenzyme A amino acid N-acyltransferase 2 Gene [Source:MGI Symbol;Acc:MGI:2444345]
bile acid-Coenzyme A: amino acid N-acyltransferase Gene [Source:MGI Symbol;Acc:MGI:106642]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9442 Essential Splice Site Available for shipment Available now
sa26304 Nonsense Mutation detected in F1 DNA During 2018
sa15409 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9442
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066943 Essential Splice Site 225 438 6 12
ENSDART00000100737 Essential Splice Site 199 412 4 10
Genomic Location (Zv9):
Chromosome 4 (position 24770640)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 25694309
GRCz11 4 25683507
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTCCAGAAAAGCTGAAAATGACTGAGGTTGATGGTACATATTTTGAGG[T/G]AAATTTAAAATGTTGACATCCTTGGATTCCTGCTTCCTTGGATCATCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26304
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066943 Nonsense 343 438 10 12
ENSDART00000100737 Nonsense 317 412 8 10
Genomic Location (Zv9):
Chromosome 4 (position 24774669)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 25698338
GRCz11 4 25687536
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAATAAAGTGTCCTCTTTTGTTGGTGAATGGTACTGATGATCAGAATTG[G/A]GCTACCGTTGAATCTGCTGAAGATGTGAGTCTATTGTTTGTATGAATGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15409
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066943 Nonsense 386 438 11 12
ENSDART00000100737 Nonsense 360 412 9 10
Genomic Location (Zv9):
Chromosome 4 (position 24776533)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 25700202
GRCz11 4 25689400
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATACCCTGATGCTGGKCATCTRATTGAACCTCCATACACACCTCACTTC[A/T]GAGCAACTAACTTCCTCCTGCATAAAATGAATGAGAAAGGCAAGCATACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link