ENSDARG00000088503

Ensembl ID:
ENSDARG00000088503

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45391 Nonsense Mutation detected in F1 DNA During 2018
sa41592 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45391
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130923 Nonsense 170 256 4 7
Genomic Location (Zv9):
Chromosome 10 (position 7508474)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 8529749
GRCz11 10 8488449
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATTTCATCTGAGAAGAAGAGCTGGGAGGACAGCAGACGAGACTGTCAA[C/T]AGAGAAAAGCAGATCTGGTCATCGCAAAGACAACAGAGGAAACAGTAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41592
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130923 Nonsense 197 256 5 7
Genomic Location (Zv9):
Chromosome 10 (position 7510502)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 8531777
GRCz11 10 8490477
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATCATTACAGACCTTTTTGAAAAAGTTTCTCCAGAATAACACTTTATG[G/A]GTTGGTTGGAGACAGACAGATGGAGACTGGAAATGGATTGACGACCCTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link