zgc:158807

Ensembl ID:
ENSDARG00000088454
ZFIN ID:
ZDB-GENE-070209-292
Description:
RING finger protein 126 [Source:RefSeq peptide;Acc:NP_001076486]
Human Orthologues:
RNF126, RNF126P1
Human Descriptions:
ring finger protein 126 pseudogene 1 [Source:HGNC Symbol;Acc:30340]
ring finger protein 126 [Source:HGNC Symbol;Acc:21151]
Mouse Orthologue:
Rnf126
Mouse Description:
ring finger protein 126 Gene [Source:MGI Symbol;Acc:MGI:1917544]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31302 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa31302
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123386 Nonsense 120 166 5 5
Genomic Location (Zv9):
Chromosome 2 (position 55473036)
Other Location(s):
Assembly Chromosome Position
GRCz11 2 54977277
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGTGTGTGTGTGTGTGTGTGTGTTTTCTCTCTACAGCACGACACGTG[T/A]CCGGTGTGCAGGAAGAGTTTGAGCGGTCAGAACACAGCCACGGATCCTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link