ssh2

Ensembl ID:
ENSDARG00000088440
ZFIN ID:
ZDB-GENE-030131-3810
Human Orthologue:
SSH2
Human Description:
slingshot homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:30580]
Mouse Orthologue:
Ssh2
Mouse Description:
slingshot homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2679255]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa28471 Essential Splice Site Mutation detected in F1 DNA During 2018
sa28470 Essential Splice Site Mutation detected in F1 DNA During 2018
sa35905 Nonsense Available for shipment Available now
sa45542 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa28471
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127845 Essential Splice Site 391 1175 11 14
Genomic Location (Zv9):
Chromosome 15 (position 27901230)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 28619470
GRCz11 15 28552346
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCTCCTGGAGTATTGGAACGACACCTACAAGTTCATTTCAAAAGCCAA[G/A]TAAGTTTCTTTTAACAGTCCTGTCTGTTTAATTTTATTTCTTTGAAAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28470
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127845 Essential Splice Site 391 1175 11 14
Genomic Location (Zv9):
Chromosome 15 (position 27901229)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 28619469
GRCz11 15 28552345
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTCCTGGAGTATTGGAACGACACCTACAAGTTCATTTCAAAAGCCAAG[T/A]AAGTTTCTTTTAACAGTCCTGTCTGTTTAATTTTATTTCTTTGAAAGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35905
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127845 Nonsense 567 1175 13 14
Genomic Location (Zv9):
Chromosome 15 (position 27900182)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 28618422
GRCz11 15 28551298
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCCACAGTGGGCTCTAAGCAGAGGAACTCCACTTTGATCCTTGCGGTG[C/T]GAGAGCCTGTTTCTCACCGTCACCCACCTCCTGCTCTACACGTCCTCGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45542
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127845 Nonsense 917 1175 14 14
Genomic Location (Zv9):
Chromosome 15 (position 27898715)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 28616955
GRCz11 15 28549831
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTGTGTTTCTTGAGGGGAGTGTTTCATTGGAGGCCGACCAGATCACTT[T/A]GAACCCCACTCTTGAGCCCAGCTCTTGTTCTTCCTCCCTGTTGTGGCTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link