zgc:110188

Ensembl ID:
ENSDARG00000088439
ZFIN ID:
ZDB-GENE-050417-373
Description:
ganglioside GM2 activator [Source:RefSeq peptide;Acc:NP_001017831]
Human Orthologue:
GM2A
Human Description:
GM2 ganglioside activator [Source:HGNC Symbol;Acc:4367]
Mouse Orthologue:
Gm2a
Mouse Description:
GM2 ganglioside activator protein Gene [Source:MGI Symbol;Acc:MGI:95762]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7391 Missense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa7391
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128971 Missense 44 200 3 5
Genomic Location (Zv9):
Chromosome 14 (position 27234432)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 25927544
GRCz11 14 26224975
KASP Assay ID:
554-4267.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTTTAATTTGTTTTTATCATCAGGTATTGGGATTTTCTTGGCAAAATT[G/A]CGGTAAACCAGATGATCCTGCAAACYTGAAGAGTCTTGATATTTCTCCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link