zgc:158849

Ensembl ID:
ENSDARG00000088414
ZFIN ID:
ZDB-GENE-070410-12
Description:
arginyl-tRNA--protein transferase 1 [Source:RefSeq peptide;Acc:NP_001082937]
Human Orthologue:
ATE1
Human Description:
arginyltransferase 1 [Source:HGNC Symbol;Acc:782]
Mouse Orthologue:
Ate1
Mouse Description:
arginyltransferase 1 Gene [Source:MGI Symbol;Acc:MGI:1333870]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44410 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44410
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127375 Nonsense 167 219 4 5
Genomic Location (Zv9):
Chromosome Zv9_NA48 (position 75618)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150046.1 75618
GRCz11 13 46627037
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAGCCGTGGGGGTTTTGGACATCCTGCCCTCTTGTGTGTCCTCTGTGTA[T/A]CTGTACTACCACCCCGACTTCTCCTCGCTCTCACTGGGCACCTACTCTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link