si:dkey-33i22.3

Ensembl ID:
ENSDARG00000088377
ZFIN ID:
ZDB-GENE-091204-67
Human Orthologue:
RP1L1
Human Description:
retinitis pigmentosa 1-like 1 [Source:HGNC Symbol;Acc:15946]
Mouse Orthologue:
Rp1l1
Mouse Description:
retinitis pigmentosa 1 homolog (human)-like 1 Gene [Source:MGI Symbol;Acc:MGI:2384303]

Alleles

There are 11 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29330 Essential Splice Site Mutation detected in F1 DNA During 2018
sa23667 Nonsense Available for shipment Available now
sa7469 Missense Mutation detected in F1 DNA During 2018
sa32286 Nonsense Available for shipment Available now
sa6628 Nonsense Mutation detected in F1 DNA During 2018
sa37002 Nonsense Mutation detected in F1 DNA During 2018
sa12633 Nonsense Available for shipment Available now
sa12624 Nonsense Available for shipment Available now
sa43409 Nonsense Mutation detected in F1 DNA During 2018
sa14900 Nonsense Available for shipment Available now
sa23668 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa29330
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122595 Essential Splice Site 230 3919 3 3
ENSDART00000138888   None 81 None 2
Genomic Location (Zv9):
Chromosome 20 (position 19209516)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 19237773
GRCz11 20 19137356
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACTTTGTATTTATTAATGTTAACTTATTTACTTTGTTTACTTTCTTGT[A/G]GTCAACTTTGGACTTGAAACAAAGAGAAGTGTCATCCACCCAAGGTGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23667
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122595 Nonsense 539 3919 3 3
ENSDART00000138888   None 81 None 2
Genomic Location (Zv9):
Chromosome 20 (position 19210444)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 19238701
GRCz11 20 19138284
KASP Assay ID:
2261-4130.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAAGTAGAGGAAGATGAGAGGTCTATATCTGTCTTGAGCTCTTCCTCA[C/T]AAATTCTAGCATCACTGAAGGAGGATCAAGATGATGACGTCAACCCCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7469
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122595 Missense 617 3919 3 3
ENSDART00000138888   None 81 None 2
Genomic Location (Zv9):
Chromosome 20 (position 19210678)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 19238935
GRCz11 20 19138518
KASP Assay ID:
554-4240.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCTTCAGGGCGGTCTAAAACTTACAGAAAGTTTGCCAGTCCYGAAGTT[G/T]GCAMTGAAGAGGTCAGGTCTGAAGCATCTGCTTCCCCCAACATTTTGTCY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32286
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122595 Nonsense 2587 3919 3 3
ENSDART00000138888   None 81 None 2
Genomic Location (Zv9):
Chromosome 20 (position 19216588)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 19244845
GRCz11 20 19144428
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGACACAAGTTCAGGCAGCGCTCCAACACTACAAAGAGGTCAGTTATCA[A/T]AAAAGATTTCTCAAGATCCAGATCCTGTATGGGTTCTGAATTTATTGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6628
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122595 Nonsense 2649 3919 3 3
ENSDART00000138888   None 81 None 2
Genomic Location (Zv9):
Chromosome 20 (position 19216776)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 19245033
GRCz11 20 19144616
KASP Assay ID:
554-4534.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACACTATGATATYCGAATTGCAAGATGAAGTCCAGAGACGCATACAATA[T/G]AGTATTGACAAGGAGCTAAAGAAGATCCATGGCAGAGCTGGCAGGCCAAR
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37002
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122595 Nonsense 2682 3919 3 3
ENSDART00000138888   None 81 None 2
Genomic Location (Zv9):
Chromosome 20 (position 19216873)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 19245130
GRCz11 20 19144713
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAAGCCACCAAAAGAAACAATATCCCGTGAATCAACCATTCAAACAGAG[C/T]AAAGGCGGAGGCGTCTGAAGGTGATGCGTAACCAATCTATTGATCCACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12633
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122595 Nonsense 2773 3919 3 3
ENSDART00000138888   None 81 None 2
ENSDART00000122595 Nonsense 2773 3919 3 3
ENSDART00000138888   None 81 None 2
Genomic Location (Zv9):
Chromosome 20 (position 19217146)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 19245403
GRCz11 20 19144986
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAAAATACTCCAGWTAAAAAAATYGTCTCCAGCCAATGAAAAGATTGAG[G/T]AGAACGCCAGTACATCTACGTCCAGTAAGATGGAGGAAGAAAATGTGGKG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12624
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122595 Nonsense 2773 3919 3 3
ENSDART00000138888   None 81 None 2
ENSDART00000122595 Nonsense 2773 3919 3 3
ENSDART00000138888   None 81 None 2
Genomic Location (Zv9):
Chromosome 20 (position 19217146)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 19245403
GRCz11 20 19144986
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAAAATACTCCAGWTAAAAAAATYGTCTCCAGCCAATGAAAAGATTGAG[G/T]AGAACGCCAGTACATCTACGTCCAGTAAGATGGAGGAAGAAAATGTGGKG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43409
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122595 Nonsense 2989 3919 3 3
ENSDART00000138888   None 81 None 2
Genomic Location (Zv9):
Chromosome 20 (position 19217794)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 19246051
GRCz11 20 19145634
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCTACAGTAGATGGGGAATCAGTTGAGGAAAAAACATCAGATGGTGGA[C/T]AAGCTGCTGAAGATAAAACTTCAAAAGATGGACAAACTGCTGATGATGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14900
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122595 Nonsense 3252 3919 3 3
ENSDART00000138888   None 81 None 2
Genomic Location (Zv9):
Chromosome 20 (position 19218583)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 19246840
GRCz11 20 19146423
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGATCAAACTTCACATGATGGACAAACTGCTGAAGGTGAAACTGCAAAG[G/T]AAAGTGAAACAGTTGAAGATGAAACTGCAGAAGGTGTACACACTGCTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23668
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122595 Nonsense 3578 3919 3 3
ENSDART00000138888   None 81 None 2
Genomic Location (Zv9):
Chromosome 20 (position 19219561)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 19247818
GRCz11 20 19147401
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACTTCTGAAGCAGAATCAGAAGATGAAGGAACCACCAATGCAGAATCT[G/T]AAATGCATGAAGGGAAAGCTACTGAAGATGGATCAACAGAACAAGATGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link