acadl

Ensembl ID:
ENSDARG00000088357
ZFIN ID:
ZDB-GENE-040426-771
Description:
long-chain specific acyl-CoA dehydrogenase, mitochondrial [Source:RefSeq peptide;Acc:NP_957475]
Human Orthologue:
ACADL
Human Description:
acyl-CoA dehydrogenase, long chain [Source:HGNC Symbol;Acc:88]
Mouse Orthologue:
Acadl
Mouse Description:
acyl-Coenzyme A dehydrogenase, long-chain Gene [Source:MGI Symbol;Acc:MGI:87866]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43157 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43157
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126978 Nonsense 141 442 4 11
Genomic Location (Zv9):
Chromosome 18 (position 37928699)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 39510402
GRCz11 18 39491410
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTGTGATGTATTGTGTGTTCTGTTTGTGTTGTAGAATGTACAGTAACTG[C/A]AGTGGTCCTGGCTTCTCTCTCCACTCTGAGATTGTAATGCCTTATATCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link