sp1

Ensembl ID:
ENSDARG00000088347
ZFIN ID:
ZDB-GENE-030131-2829
Description:
transcription factor Sp1 [Source:RefSeq peptide;Acc:NP_997827]
Human Orthologue:
SP1
Human Description:
Sp1 transcription factor [Source:HGNC Symbol;Acc:11205]
Mouse Orthologue:
Sp1
Mouse Description:
trans-acting transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:98372]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21821 Nonsense Available for shipment Available now
sa21820 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21821
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124104 Nonsense 52 594 3 6
Genomic Location (Zv9):
Chromosome 11 (position 91978)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 24473
GRCz11 11 24473
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCTGTTTCTCTCTGCAGGACTCGCAGCAGCCATCACCGCTAGCACTGT[T/A]AGCCGCTACGTGCAGTCGCATCGATGAGAACGGCGCGGCGGAGCCTCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21820
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124104 Nonsense 156 594 3 6
Genomic Location (Zv9):
Chromosome 11 (position 91667)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 24162
GRCz11 11 24162
GRCz11 KZ116046.1 5367
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAACATCCAGTACCAGGTGATCCCGCAGTTCCAGACGGTGGACGGGCAG[C/T]AGCTGCAGCTCCAGGCAGCGCAGGACATGTCTGGGCAGCTGTTGGTGTCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link