alx4a

Ensembl ID:
ENSDARG00000088332
ZFIN ID:
ZDB-GENE-070712-3
Human Orthologue:
ALX4
Human Description:
ALX homeobox 4 [Source:HGNC Symbol;Acc:450]
Mouse Orthologue:
Alx4
Mouse Description:
aristaless-like homeobox 4 Gene [Source:MGI Symbol;Acc:MGI:108359]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34077 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa34077
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124363 Nonsense 354 368 4 4
Genomic Location (Zv9):
Chromosome 7 (position 28023085)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 26626024
GRCz11 7 26897217
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGACTTAAACATGGACCCCGACCGGAAATCCTCCAGCATTGCAGCACTG[C/T]GAATGAAAGCTAAAGAACACAGTGCAGCCATCTCTTGGGCTACATGACTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link