LOC793956

Ensembl ID:
ENSDARG00000088307
Human Orthologue:
MKL2
Human Description:
MKL/myocardin-like 2 [Source:HGNC Symbol;Acc:29819]
Mouse Orthologue:
Mkl2
Mouse Description:
MKL/myocardin-like 2 Gene [Source:MGI Symbol;Acc:MGI:3050795]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35271 Essential Splice Site Mutation detected in F1 DNA During 2018
sa35272 Nonsense Mutation detected in F1 DNA During 2018
sa44760 Nonsense Mutation detected in F1 DNA During 2018
sa22081 Nonsense Available for shipment Available now
sa10017 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35271
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127655 Essential Splice Site 46 986 1 15
Genomic Location (Zv9):
Chromosome 12 (position 21088579)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 19870423
GRCz11 12 19992297
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCCTGCACCCCAGCCAGAGGCTTCCTCCTCTCAATGAGCGCAAAAATGG[T/G]AAGTCTTGCTGAGATGAACTAATCAAAACTGTTGGTTTGAGTCTTCTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35272
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127655 Nonsense 181 986 6 15
Genomic Location (Zv9):
Chromosome 12 (position 21114968)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 19896812
GRCz11 12 20018686
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTAGATGGTCAGATGCAGTACCCTAGAACTCTAGAAGATCTAATAGAT[G/T]AAGACAGTGGAGATGCTTTTTCACCAGAGCAGCCAGCCAGTCAGGAGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44760
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127655 Nonsense 317 986 8 15
Genomic Location (Zv9):
Chromosome 12 (position 21122220)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 19904064
GRCz11 12 20025938
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCCCAGATCAGAAACAAGAACCCGACCAAGCCCCGATGGACTCCTCGTA[T/A]GCTCGTTTACTACAACAACAGCAGCTATTTTTGCAGCTACAGATCCTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22081
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127655 Nonsense 416 986 10 15
Genomic Location (Zv9):
Chromosome 12 (position 21125819)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 19907663
GRCz11 12 20029537
KASP Assay ID:
2260-5301.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTACTAATAATGTGTTTATTTTGGCAGGTGGCAGAGCTGAAAATGGAGT[T/A]GAAGTTGCGTGGTCTTCCAGTATCAGGAACAAAAACTGACCTTATTGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10017
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127655 Nonsense 758 986 12 15
Genomic Location (Zv9):
Chromosome 12 (position 21131073)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 19912917
GRCz11 12 20034791
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTAGCTCCCCAGAGAACAGAACCTCACCTCAGACGTCCCCCATCCCAT[C/A]ATCCCTTATCAATGGACAACTAAACAAGGTAGAACTTTTTGTTTTTATTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • Menarche (age at onset): Thirty new loci for age at menarche identified by a meta-analysis of genome-wide association studies. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link