zranb3

Ensembl ID:
ENSDARG00000088281
ZFIN ID:
ZDB-GENE-060712-1
Description:
Zranb3 protein [Source:UniProtKB/TrEMBL;Acc:Q6DC67]
Human Orthologue:
ZRANB3
Human Description:
zinc finger, RAN-binding domain containing 3 [Source:HGNC Symbol;Acc:25249]
Mouse Orthologue:
Zranb3
Mouse Description:
zinc finger, RAN-binding domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:1918362]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37454 Nonsense Mutation detected in F1 DNA During 2018
sa45757 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa37454
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123231 Nonsense 152 269 4 6
ENSDART00000136408 Nonsense 147 264 3 5
Genomic Location (Zv9):
Chromosome 22 (position 12403748)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 12256989
GRCz11 22 12291037
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATTTGACATCTTGCTCTTTCTTTCAGCTTTTCATGCAAATCGATGCTT[T/A]GTATCCGCGGAGGTTTGGAACCTGGAGTGACTACGCCAACAAATACTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45757
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123231 Essential Splice Site 173 269 5 6
ENSDART00000136408 Essential Splice Site 168 264 4 5
Genomic Location (Zv9):
Chromosome 22 (position 12408147)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 12252590
GRCz11 22 12286638
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAAATGAGATGGATGTGAATTATGTGTGTGTGTGTGTTTTGTTTGCGC[A/T]GGTATTTCGGGGCCAGACGGCAGTGGGATTGTCGCGGCGCGTCTCATTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link