zgc:174356

Ensembl ID:
ENSDARG00000088263
ZFIN ID:
ZDB-GENE-080215-21
Description:
zgc:174356 (zgc:174356), mRNA [Source:RefSeq DNA;Acc:NM_001114717]
Human Orthologues:
SLC46A1, SLC46A2, SLC46A3
Human Descriptions:
solute carrier family 46 (folate transporter), member 1 [Source:HGNC Symbol;Acc:30521]
solute carrier family 46, member 2 [Source:HGNC Symbol;Acc:16055]
solute carrier family 46, member 3 [Source:HGNC Symbol;Acc:27501]
Mouse Orthologues:
Slc46a1, Slc46a2, Slc46a3
Mouse Descriptions:
solute carrier family 46, member 1 Gene [Source:MGI Symbol;Acc:MGI:1098733]
solute carrier family 46, member 2 Gene [Source:MGI Symbol;Acc:MGI:1353616]
solute carrier family 46, member 3 Gene [Source:MGI Symbol;Acc:MGI:1918956]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36486 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa36486
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128863 Nonsense 92 464 2 7
Genomic Location (Zv9):
Chromosome 17 (position 39414541)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 39299438
GRCz11 17 39247023
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCATCCTCAGCCTGGTCTCCATCCCTCCTGCCATCATGCTGGGCTCGT[G/A]GTCAGATAGCGCTGGCCGTCGATCAGTCATGGCTCTGCCGTCAGTTCTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link