wu:fb52c12

Ensembl ID:
ENSDARG00000088195
ZFIN ID:
ZDB-GENE-030131-897
Human Orthologues:
DACT1, DACT2, DACT3
Human Descriptions:
dapper, antagonist of beta-catenin, homolog 1 (Xenopus laevis) [Source:HGNC Symbol;Acc:17748]
dapper, antagonist of beta-catenin, homolog 2 (Xenopus laevis) [Source:HGNC Symbol;Acc:21231]
dapper, antagonist of beta-catenin, homolog 3 (Xenopus laevis) [Source:HGNC Symbol;Acc:30745]
Mouse Orthologues:
Dact1, Dact2, Dact3
Mouse Descriptions:
dapper homolog 1, antagonist of beta-catenin (xenopus) Gene [Source:MGI Symbol;Acc:MGI:1891740]
dapper homolog 2, antagonist of beta-catenin (xenopus) Gene [Source:MGI Symbol;Acc:MGI:1920347]
dapper homolog 3, antagonist of beta-catenin (xenopus) Gene [Source:MGI Symbol;Acc:MGI:3654828]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10434 Essential Splice Site Available for shipment Available now
sa22538 Essential Splice Site Available for shipment Available now
sa35753 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa10434
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125970 Essential Splice Site 77 974 1 4
Genomic Location (Zv9):
Chromosome 14 (position 48334301)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 46406881
GRCz11 14 45394173
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACCGGAGCGCRCCGCCGAGGATGGCACCGCAGCCTCCCGCGGGCAACAG[G/A]TCAGTGGGGACGTGGGAAAAATAATACYCAACATGTTCCTTGTTATTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22538
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125970 Essential Splice Site 77 974 1 4
Genomic Location (Zv9):
Chromosome 14 (position 48334300)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 46406880
GRCz11 14 45394172
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCGGAGCGCGCCGCCGAGGATGGCACCGCAGCCTCCCGCGGGCAACAGG[T/G]CAGTGGGGACGTGGGAAAAATAATACCCAACATGTTCCTTGTTATTTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35753
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125970 Nonsense 789 974 4 4
Genomic Location (Zv9):
Chromosome 14 (position 48306177)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 46378757
GRCz11 14 45366049
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTACTCAAACTCCTAAAAAAGGTGGGAAATTTTGGAAAGGCTTTGAAACT[C/T]GATTTTGGGGGCGAGAAGAGGAAGATGACGATGATGAAGATGAGAGAGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link