Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ENSDARG00000088127
- Ensembl ID:
- ENSDARG00000088127
Alleles
There are 3 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa28012 | Nonsense | Mutation detected in F1 DNA | During 2018 |
| sa30966 | Nonsense | Mutation detected in F1 DNA | During 2018 |
| sa6273 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa28012
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000122637 | Nonsense | 5 | 249 | 1 | 5 |
- Genomic Location (Zv9):
- Chromosome 12 (position 45791438)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 44686376 GRCz11 12 45103194 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCTCTAAAACAAAGTCGCAGGTTTGAAATCACCACTGATGTGCTGTTTTT[C/A]GGGTTTCGTCTTTCTTAGGTACCCTTTCCCGACGGTCTTCAGCACGTGCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa30966
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000122637 | Nonsense | 99 | 249 | 2 | 5 |
- Genomic Location (Zv9):
- Chromosome 12 (position 45798890)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 44693828 GRCz11 12 45110628 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACACTGAAGGAGGAGGCCGTCTGTGCTCATGGACAGTGTTGTGAAAACTG[T/A]CAGGTAAATGCTGAAGTTTGCATGTTCTCTCCGTGTCCGCGTGGGTTTCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa6273
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000122637 | Nonsense | 211 | 249 | 5 | 5 |
- Genomic Location (Zv9):
- Chromosome 12 (position 45807172)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 44702110 GRCz11 12 45118853 - KASP Assay ID:
- 554-4224.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGTTTCCTCCTGTTKTTTTCCAGAGATGCCAAATGTGGGAAGATCCAGTG[T/A]CAGGGTGGAGCCAACCGGCCGGYRATAGGCACCAATGCYGTTTCCATTGA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
