UNC13C (3 of 4)

Ensembl ID:
ENSDARG00000087946
Description:
unc-13 homolog C (C. elegans) [Source:HGNC Symbol;Acc:23149]
Human Orthologue:
UNC13C
Human Description:
unc-13 homolog C (C. elegans) [Source:HGNC Symbol;Acc:23149]
Mouse Orthologue:
Unc13c
Mouse Description:
unc-13 homolog C (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:2149021]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa30486 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa30486
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127178 Nonsense 51 240 2 6
Genomic Location (Zv9):
Chromosome Zv9_NA492 (position 40475)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150243.1 39464
GRCz11 KN150243.2 40475
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTCCACTACCTGACGGAGGTGAAGAACAATGGAGTGGTGAAGATCCCG[C/T]AGGTGAAAGGAGATGACGCCTGGAAGGTTTATTTTGACGATGTTTCGCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link