zgc:153726

Ensembl ID:
ENSDARG00000087937
ZFIN ID:
ZDB-GENE-060929-974
Description:
cell division protein kinase 4 [Source:RefSeq peptide;Acc:NP_001071245]
Human Orthologue:
CDK4
Human Description:
cyclin-dependent kinase 4 [Source:HGNC Symbol;Acc:1773]
Mouse Orthologue:
Cdk4
Mouse Description:
cyclin-dependent kinase 4 Gene [Source:MGI Symbol;Acc:MGI:88357]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41744 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41744
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092787 Nonsense 188 297 4 7
Genomic Location (Zv9):
Chromosome 11 (position 185122)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 173663
GRCz11 11 136098
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGTGTCAGGTGGTGACGCTGTGGTATCGCTCTCCTGAGGTGCTCCTG[C/T]AGAGCACATACGCCACACCAGTGGACATCTGGAGCACCGGCTGCATCTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link