PLCE1 (1 of 2)

Ensembl ID:
ENSDARG00000087921
Description:
phospholipase C, epsilon 1 [Source:HGNC Symbol;Acc:17175]
Human Orthologue:
PLCE1
Human Description:
phospholipase C, epsilon 1 [Source:HGNC Symbol;Acc:17175]
Mouse Orthologue:
Plce1
Mouse Description:
phospholipase C, epsilon 1 Gene [Source:MGI Symbol;Acc:MGI:1921305]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35206 Essential Splice Site Mutation detected in F1 DNA During 2018
sa6233 Nonsense Mutation detected in F1 DNA During 2018
sa35205 Nonsense Available for shipment Available now
sa38872 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa35206
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124097 Essential Splice Site 552 1157 13 22
Genomic Location (Zv9):
Chromosome 12 (position 6408577)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 5342748
GRCz11 12 5377705
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCCGTGACCTTACATATGTGTTTGTTTGTGTTTGTGTGCGTGGGAACT[A/G]GGCCTCTCCACCCTCTCTCCATCAGGCTCTGGAAGGGGGAAAGACAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6233
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124097 Nonsense 729 1157 15 22
Genomic Location (Zv9):
Chromosome 12 (position 6405709)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 5345616
GRCz11 12 5380573
KASP Assay ID:
554-4591.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCCTCCAGTCCTGTGGGACAGAAGCTGTCCTCTCTATCAGCACTTTTA[C/A]CCTCTGGACCGAGACCTGGAGAACATGACCCCAACGCTATACACACTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35205
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124097 Nonsense 736 1157 15 22
Genomic Location (Zv9):
Chromosome 12 (position 6405690)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 5345635
GRCz11 12 5380592
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGAAGCTGTCCTCTCTATCAGCACTTTTACCCTCTGGACCGAGACCTG[G/T]AGAACATGACCCCAACGCTATACACACTCACTGTAAGAATACACACAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38872
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124097 Nonsense 976 1157 19 22
Genomic Location (Zv9):
Chromosome 12 (position 6397492)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 5353833
GRCz11 12 5388790
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCAGCCTGAGGACGGATATGTGGGCAGAATATACCTCAAAACCAGAGAA[C/T]AGGTAGAACAAAAGCTTTCCCAGATTCTGCTTACTTACTTTTTATGTAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link