
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
mib
- Ensembl ID:
- ENSDARG00000087895
- ZFIN ID:
- ZDB-GENE-030404-2
- Description:
- E3 ubiquitin-protein ligase mib1 [Source:UniProtKB/Swiss-Prot;Acc:Q804S5]
- Human Orthologue:
- MIB1
- Human Description:
- mindbomb homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:21086]
- Mouse Orthologue:
- Mib1
- Mouse Description:
- mindbomb homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2443157]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa31118 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa44378 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa31118
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000128234 | Nonsense | 168 | 570 | 3 | 11 |
- Genomic Location (Zv9):
- Chromosome Zv9_scaffold3504 (position 58964)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 4240223 GRCz11 2 4081172 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCTTTGCAGGAGGACGAGTGGTGCGAGGGGTGGATTGGCAATGGGAGGAT[C/T]AGGATGGCGGGAATGGAAGAAGAGGGAAGGTAATGCCTCGACACGTCTGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa44378
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000128234 | Nonsense | 175 | 570 | 3 | 11 |
- Genomic Location (Zv9):
- Chromosome Zv9_scaffold3504 (position 58943)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 4240244 GRCz11 2 4081193 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGCGAGGGGTGGATTGGCAATGGGAGGATCAGGATGGCGGGAATGGAAGA[A/T]GAGGGAAGGTAATGCCTCGACACGTCTGACTATGCTCACCTTCCTGTGCT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: