
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
GPR113 (2 of 2)
- Ensembl ID:
- ENSDARG00000087870
- Description:
- G protein-coupled receptor 113 [Source:HGNC Symbol;Acc:18989]
- Human Orthologue:
- GPR113
- Human Description:
- G protein-coupled receptor 113 [Source:HGNC Symbol;Acc:18989]
- Mouse Orthologue:
- Gpr113
- Mouse Description:
- G protein-coupled receptor 113 Gene [Source:MGI Symbol;Acc:MGI:2685887]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa22989 | Nonsense | Available for shipment | Available now |
sa11720 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa22989
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000124293 | Nonsense | 449 | 1024 | 12 | 17 |
- Genomic Location (Zv9):
- Chromosome 17 (position 6348865)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 6427801 GRCz11 17 6585031 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAAAGCGGTTATACAGCCACCATGCCTTGTGACAACTCTGGTGTTGGTTG[G/A]AGAACAAGAAAATGCAATGGCACTAGGTGGTCTACTGAAATCTCTACTTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa11720
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000124293 | Essential Splice Site | 993 | 1024 | 16 | 17 |
- Genomic Location (Zv9):
- Chromosome 17 (position 6360729)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 6439665 GRCz11 17 6596895 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AATCTTACAGCTTTACGATTCTCKAACTTAATTGTACWTCTTTYATTTAA[A/T]GGTTCGTGATGCACTTCTGAAGCGTTTCAAAATCAWGGTTAGTTTGTGCA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Non-small cell lung cancer: Prognostic implications of genetic variants in advanced non-small cell lung cancer: a genome-wide association study. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: