zgc:153597

Ensembl ID:
ENSDARG00000087868
ZFIN ID:
ZDB-GENE-061027-232
Description:
hypothetical protein LOC768294 [Source:RefSeq peptide;Acc:NP_001070926]
Human Orthologues:
AC008537.2, CYP2A7P1
Human Description:
cytochrome P450, family 2, subfamily A, polypeptide 7 pseudogene 1 [Source:HGNC Symbol;Acc:2612]
Mouse Orthologues:
Cyp2ab1, Cyp2j13
Mouse Descriptions:
cytochrome P450, family 2, subfamily ab, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:3644957]
cytochrome P450, family 2, subfamily j, polypeptide 13 Gene [Source:MGI Symbol;Acc:MGI:2385197]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44052 Essential Splice Site Mutation detected in F1 DNA During 2018
sa44051 Nonsense Mutation detected in F1 DNA During 2018
sa37786 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44052
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006065 Essential Splice Site 66 498 2 9
Genomic Location (Zv9):
Chromosome 23 (position 42858578)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 42492381
GRCz11 23 42457877
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTTTTTAATCATTTACAAACTGAATCTGCTGTAAATGTTTTCCAAACA[G/A]TTGTCTGAATATGGAGGATTGGCCACTGTGTTTATTGGGAGAAAGCCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44051
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006065 Nonsense 151 498 3 9
Genomic Location (Zv9):
Chromosome 23 (position 42856834)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 42494125
GRCz11 23 42459621
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTGCACACACTCAGAAACTTTGGTCTGGGGAAGAAAACAGTAGAGGAT[C/T]GAGTGTTAGAGGAAAGCCAGTATCTGATTGCTGAAATGCTCAAAGATGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37786
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006065 Nonsense 191 498 4 9
Genomic Location (Zv9):
Chromosome 23 (position 42856581)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 42494378
GRCz11 23 42459874
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCATGCCCTACAGAATGCTGTTTCCAACATTATCTGCTCCATCGTGTTT[G/T]GAGATCGCTTTGAGTATGATAACAAACGCTTTGAATACCTTCTGAAAATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link