
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ece1
- Ensembl ID:
- ENSDARG00000087841
- Human Orthologue:
- ECE2
- Human Description:
- endothelin converting enzyme 2 [Source:HGNC Symbol;Acc:13275]
- Mouse Orthologue:
- Ece2
- Mouse Description:
- endothelin converting enzyme 2 Gene [Source:MGI Symbol;Acc:MGI:1101356]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa35796 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa4586 | Essential Splice Site | F2 line generated | During 2018 |
sa35795 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa35796
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000125867 | Nonsense | 305 | 767 | 7 | 18 |
- Genomic Location (Zv9):
- Chromosome 15 (position 4065477)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 4210787 GRCz11 15 4202259 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTTGTTGGGAGGAGACAAGAATTCCACTCGGGGTCAGATGCAGCAGATTT[T/A]GGACTTTGAGACGGCGCTGGCGAACATCACCGTGCCCCAGGACGAACGGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa4586
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000125867 | Essential Splice Site | 460 | 767 | 10 | 18 |
- Genomic Location (Zv9):
- Chromosome 15 (position 4051962)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 3987514 GRCz11 15 4189543 - KASP Assay ID:
- 554-3569.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GGGAGCTCTTTTCGTCAAAGCCACCTTCGACAAACAGAGCAAAGAAATAG[T/C]GAGTTGCTTCATGTGTCGTATTACAGTTGAAGTCAAATGTATTAGCCCGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa35795
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000125867 | Essential Splice Site | 493 | 767 | 11 | 18 |
- Genomic Location (Zv9):
- Chromosome 15 (position 4049867)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 3985419 GRCz11 15 4187448 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATGATTTGAAGTGGATGGATGAACAGACCCGACAAGCTGCCAAGGACAAG[G/A]TGAGAGAGAGAATGAGATTTGCAGCAGCATGACTGGATCACCAAAACTTA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Major depressive disorder: A mega-analysis of genome-wide association studies for major depressive disorder. (View Study)
- Menarche (age at onset): Thirty new loci for age at menarche identified by a meta-analysis of genome-wide association studies. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: