wu:fj34h05

Ensembl ID:
ENSDARG00000087822
ZFIN ID:
ZDB-GENE-030131-7799
Human Orthologue:
AGAP3
Human Description:
ArfGAP with GTPase domain, ankyrin repeat and PH domain 3 [Source:HGNC Symbol;Acc:16923]
Mouse Orthologue:
Agap3
Mouse Description:
ArfGAP with GTPase domain, ankyrin repeat and PH domain 3 Gene [Source:MGI Symbol;Acc:MGI:2183446]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24533 Nonsense Available for shipment Available now
sa10330 Nonsense Available for shipment Available now
sa17974 Nonsense Available for shipment Available now
sa37933 Essential Splice Site Mutation detected in F1 DNA During 2018
sa37932 Nonsense Mutation detected in F1 DNA During 2018
sa37931 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa24533
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128690 Nonsense 204 1047 1 13
Genomic Location (Zv9):
Chromosome 24 (position 35679283)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 34448963
GRCz11 24 34335138
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTCACAGTTTTTGCATGTTGGAAGCAACCAACTCTAAACAAGTTATTT[T/A]GCCTACCTCTGCTTCCACTAATCATGGTTTTCCAGATGTGGTCCAGCGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10330
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128690 Nonsense 317 1047 1 13
Genomic Location (Zv9):
Chromosome 24 (position 35678945)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 34448625
GRCz11 24 34334800
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTGGAAATGGTTWGGTCGACAGGCAACTGGAAAAGAAAWGGGGGTGAYA[C/T]AAATTTCAGCAAAGCTGAAGGAATCTAACAAAKAAGAAGCACCCAAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17974
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128690 Nonsense 342 1047 1 13
Genomic Location (Zv9):
Chromosome 24 (position 35678869)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 34448549
GRCz11 24 34334724
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAACAAAKAAGAAGCACCCAAAAAAATGTTCGGATCGCTGAGAAGGAGTT[T/A]GAGCCTCCGGATGAGACGAAATYGTAATCAAYCTGAGCATGAGGACAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37933
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128690 Essential Splice Site 541 1047 3 13
Genomic Location (Zv9):
Chromosome 24 (position 35660107)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 34429787
GRCz11 24 34315962
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCACCGGTATCTGACAGGAACATATGTCCAGGAGGAGTCGCCTGAGGG[T/C]GAGTGAACAGCGGGACGCTCAATACAGAGTGTTTGTCAGGCCGGTCACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37932
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128690 Nonsense 750 1047 8 13
Genomic Location (Zv9):
Chromosome 24 (position 35626324)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 34396004
GRCz11 24 34282179
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACCGTCGCCGCCTCCAACACTCCTACGCCCATCCGCAAGCAGTCCAAG[C/T]GACGCTCCAACATCTTCACAGTAAGTATGAGGCAGCTAATGCAGAGCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37931
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128690 Nonsense 842 1047 11 13
Genomic Location (Zv9):
Chromosome 24 (position 35599610)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 34369290
GRCz11 24 34255465
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCATGGTAAAGAGATCGATCTGCTGCGGACGACGGTGAAGGTGCCAGGG[A/T]AGAGACCGCCTAGAGCAGTGGCTACAGTCGCCCCTACAGCCAGTCCAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link