si:dkey-30g5.1

Ensembl ID:
ENSDARG00000087817
ZFIN ID:
ZDB-GENE-091116-100
Human Orthologue:
GIMAP8
Human Description:
GTPase, IMAP family member 8 [Source:HGNC Symbol;Acc:21792]
Mouse Orthologue:
Gimap8
Mouse Description:
GTPase, IMAP family member 8 Gene [Source:MGI Symbol;Acc:MGI:2685303]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39966 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39966
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041941 Nonsense 227 257 3 3
ENSDART00000105014   None 217 None 3
ENSDART00000130134   None 457 None 2
Genomic Location (Zv9):
Chromosome 3 (position 942148)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 435616
GRCz11 3 3100114
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACAAATGAGATGTATGAATATGCACAAACCTGCACATTTGAATGGTTTT[G/A]GGAAAAATCCAAGGTATTTTTCATTGTTCTCATCAATATACTCTTGGGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link