
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
NLRX1 (24 of 33)
- Ensembl ID:
- ENSDARG00000087736
- Description:
- NLR family member X1 [Source:HGNC Symbol;Acc:29890]
- Human Orthologue:
- NLRX1
- Human Description:
- NLR family member X1 [Source:HGNC Symbol;Acc:29890]
- Mouse Orthologue:
- Nlrx1
- Mouse Description:
- NLR family member X1 Gene [Source:MGI Symbol;Acc:MGI:2429611]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa42564 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa42564
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000122159 | Nonsense | 341 | 887 | 1 | 7 |
- Genomic Location (Zv9):
- Chromosome 15 (position 27705780)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 28424020 GRCz11 15 28356896 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGGTCAGCCAGTATTACAGCCTGTTGGGTTTCTCTGTAGATCAGCAGAAG[C/T]AGTACTTTGAGAAGAACTGCAGATCTCCTGAGGCTGCTGCTGCAGTTTGG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: