C16orf11

Ensembl ID:
ENSDARG00000087663
Description:
chromosome 16 open reading frame 11 [Source:HGNC Symbol;Acc:14139]
Human Orthologue:
C16orf11
Human Description:
chromosome 16 open reading frame 11 [Source:HGNC Symbol;Acc:14139]
Mouse Orthologues:
A930017K11Rik, Nhlrc4
Mouse Descriptions:
NHL repeat containing 4 Gene [Source:MGI Symbol;Acc:MGI:3687200]
RIKEN cDNA A930017K11 gene Gene [Source:MGI Symbol;Acc:MGI:2442713]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45839 Nonsense Mutation detected in F1 DNA During 2018
sa16751 Nonsense Available for shipment Available now
sa11215 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa45839
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128747 Nonsense 117 634 1 2
Genomic Location (Zv9):
Chromosome 24 (position 39506437)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 38115526
GRCz11 24 38003423
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGATGAGCCCTCGCACTCATCAGCCAATCTGGAGGAGGAAGAAACTGAA[A/T]AAAGAGATGAAAAAGATGAAGACATCCAAGAAGCAAATGCAGAAAACCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16751
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128747 Nonsense 228 634 1 2
Genomic Location (Zv9):
Chromosome 24 (position 39506104)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 38115193
GRCz11 24 38003090
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCGGCTCCRTCGCTACCCTGCTATCCTCCGGTCTCAACGAGTCAAATC[G/T]AATGCTCAGATCCACCAGCGTTCAATCTGTCTTTACTYGGTGTGGGTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11215
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128747 Nonsense 282 634 1 2
Genomic Location (Zv9):
Chromosome 24 (position 39505941)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 38115030
GRCz11 24 38002927
KASP Assay ID:
2261-9027.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCACCTCTACCATTCCTAGCATCACAGCTAGCGCACTCRCAGAGACACT[C/A]GGAGCGTTCTCTACTCCCTCCGCATCTGTATTATCCGTTCTTGTGCGAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link