
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ENSDARG00000087618
- Ensembl ID:
- ENSDARG00000087618
- Human Orthologues:
- MUC12, MUC16, MUC17, MUC20, MUC4, MUC5B
- Human Descriptions:
- mucin 12, cell surface associated [Source:HGNC Symbol;Acc:7510]
- mucin 16, cell surface associated [Source:HGNC Symbol;Acc:15582]
- mucin 17, cell surface associated [Source:HGNC Symbol;Acc:16800]
- mucin 20, cell surface associated [Source:HGNC Symbol;Acc:23282]
- mucin 4, cell surface associated [Source:HGNC Symbol;Acc:7514]
- mucin 5B, oligomeric mucus/gel-forming [Source:HGNC Symbol;Acc:7516]
- Mouse Orthologues:
- Muc20, Muc4
- Mouse Descriptions:
- mucin 20 Gene [Source:MGI Symbol;Acc:MGI:2385039]
- mucin 4 Gene [Source:MGI Symbol;Acc:MGI:2153525]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa25384 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa25384
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000127294 | Essential Splice Site | 606 | 771 | 4 | 8 |
- Genomic Location (Zv9):
- Chromosome 8 (position 2374920)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 2141309 GRCz11 8 2199852 - KASP Assay ID:
- 554-7322.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCTATTATAGTGGCTAACAGCTCAAAACCAACCCCTCTCCCAACAACAGG[T/C]ATGTTTTTCATTTTTCTGTATCATGTTAGGGGATACTCCAATATTCATAT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: