si:dkey-237h12.3

Ensembl ID:
ENSDARG00000087599
ZFIN ID:
ZDB-GENE-081027-3
Human Orthologue:
ODZ3
Human Description:
odz, odd Oz/ten-m homolog 3 (Drosophila) [Source:HGNC Symbol;Acc:29944]
Mouse Orthologue:
Odz3
Mouse Description:
odd Oz/ten-m homolog 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1345183]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8543 Essential Splice Site Mutation detected in F1 DNA During 2018
sa24965 Nonsense Mutation detected in F1 DNA During 2018
sa5872 Nonsense Mutation detected in F1 DNA During 2018
sa15467 Nonsense Available for shipment Available now
sa22527 Essential Splice Site Available for shipment Available now
sa22526 Nonsense Available for shipment Available now
sa42428 Nonsense Mutation detected in F1 DNA During 2018
sa22525 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa8543
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125345 Essential Splice Site 362 2467 6 26
ENSDART00000136233 Essential Splice Site 360 2446 6 24
Genomic Location (Zv9):
Chromosome 14 (position 38108910)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 36302003
GRCz11 14 36642317
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGATCCTGCATATGTAACCCTGGCTTCAGAGGTGACAACTGCGACCAAG[G/T]TAACTGGACARTTTTCAGTAGCTATGCAAAGAAACTCCAACACATGTAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24965
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125345 Nonsense 459 2467 8 26
ENSDART00000136233 Nonsense 457 2446 8 24
Genomic Location (Zv9):
Chromosome 14 (position 38095178)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 36315735
GRCz11 14 36656049
KASP Assay ID:
554-7356.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTTGGAGGTGTGTGTCGGTGTGCGGACGGCTGGTCGGGGGCCGGGTGT[G/T]AACAGGAGGACTGTCAGGCTCACTGTGGGGAGCATGGTGTGTGTCGAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5872
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125345 Nonsense 887 2467 16 26
ENSDART00000136233 Nonsense 876 2446 15 24
Genomic Location (Zv9):
Chromosome 14 (position 38051039)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 36359874
GRCz11 14 36700188
KASP Assay ID:
554-3831.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGCTGTTTTTCCCCTCTTCTACTCCCTCTGGTGTACAGGGATCCTGTA[T/G]AAAGGGAACGGTGAGAATGTGTTCCTCTCTCAGCTTCCTCCCATCATMAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15467
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125345 Nonsense 1739 2467 24 26
ENSDART00000136233 Nonsense 1718 2446 22 24
Genomic Location (Zv9):
Chromosome 14 (position 38034255)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 36376658
GRCz11 14 36716972
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACAAGCTCTCGGAGGTTCTGTATGACAGCACTCGTGTCAGCTTCACCTA[T/A]GATGAGACAGCAGGTGTGCTGAAGACAGTCAATCTGCAGAGCGAGGGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22527
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125345 Essential Splice Site 2174 2467 24 26
ENSDART00000136233 Essential Splice Site 2153 2446 22 24
Genomic Location (Zv9):
Chromosome 14 (position 38032950)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 36377963
GRCz11 14 36718277
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAACAACCCAATAAGTAAAGTGCAGAAAGTTGGGGACTACTTAACAGG[T/C]ACTCCATGGATTCACTGCATCTTCAAATAACTACTGGAAGTAATCTATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22526
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125345 Nonsense 2256 2467 26 26
ENSDART00000136233 Nonsense 2235 2446 24 24
Genomic Location (Zv9):
Chromosome 14 (position 38030940)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 36379973
GRCz11 14 36720287
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCAGGTGGAGTTCGGCCACAGCCACTGTTCCTCCAAACCCTGGCTGTG[G/A]TTTGCCTTGAGCGATTCGCTGATAGGTCGTGGGATCATGCTGGCACTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42428
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125345 Nonsense 2262 2467 26 26
ENSDART00000136233 Nonsense 2241 2446 24 24
Genomic Location (Zv9):
Chromosome 14 (position 38030923)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 36379990
GRCz11 14 36720304
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACAGCCACTGTTCCTCCAAACCCTGGCTGTGGTTTGCCTTGAGCGATT[C/A]GCTGATAGGTCGTGGGATCATGCTGGCACTTTACAAGGGCATCGTGATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22525
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125345 Nonsense 2431 2467 26 26
ENSDART00000136233 Nonsense 2410 2446 24 24
Genomic Location (Zv9):
Chromosome 14 (position 38030417)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 36380496
GRCz11 14 36720810
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCCAGACTCTGGACTGAAGGGGAAAAAAGGCAGCTTCTTACCAGTGGA[C/T]GAGTTCAAGGCTATGATGGATACTACGTGCTGTCGGTAGAGCAGTATCCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Response to amphetamines: Genome-wide association study of d-amphetamine response in healthy volunteers identifies putative associations, including cadherin 13 (CDH13). (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link