
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ENSDARG00000087596
- Ensembl ID:
- ENSDARG00000087596
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa39064 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa32054 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa39064
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000130129 | Essential Splice Site | 540 | 807 | 5 | 9 |
- Genomic Location (Zv9):
- Chromosome 15 (position 34275894)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 35121670 GRCz11 15 34979639 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAATTATGAATGCACATGCACATTATCCTTCATTTCTGTGTTTTTAAATC[A/C]GACGGTTTTGGAGGCTCAGCTGTCTGAGGCGAGCGAGAGAGAGAAAGCTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32054
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000130129 | Nonsense | 627 | 807 | 6 | 9 |
- Genomic Location (Zv9):
- Chromosome 15 (position 34278759)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 35124535 GRCz11 15 34982504 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAGTGTGGAAAGAGCGAGATTCAGCCCTGACTGCACTGGTGCAGGACAAC[A/T]AAGACTACATTTCCCAGTTAAAGGAGGCGCTTGAGAGTTCACGCAGAGAC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: