SPTBN4 (1 of 3)

Ensembl ID:
ENSDARG00000087594
Description:
spectrin, beta, non-erythrocytic 4 [Source:HGNC Symbol;Acc:14896]
Human Orthologue:
SPTBN4
Human Description:
spectrin, beta, non-erythrocytic 4 [Source:HGNC Symbol;Acc:14896]
Mouse Orthologue:
Spnb4
Mouse Description:
spectrin beta 4 Gene [Source:MGI Symbol;Acc:MGI:1890574]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39219 Nonsense Mutation detected in F1 DNA During 2018
sa39218 Nonsense Mutation detected in F1 DNA During 2018
sa23377 Nonsense Available for shipment Available now
sa32220 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa39219
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078561 Nonsense 108 1177 3 17
Genomic Location (Zv9):
Chromosome 18 (position 44477909)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 46063403
GRCz11 18 46061421
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAGATGTGGCGTAACTCTGTGCTGTTCATCTGCTCTCAGACTCTTCAG[C/T]GAGAGCTTCATGGCCACCGCTCGCGGGTGGAGGACGTCCTGGAGCGAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39218
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078561 Nonsense 209 1177 4 17
Genomic Location (Zv9):
Chromosome 18 (position 44475990)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 46061484
GRCz11 18 46059502
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCTCTGTCTGTTCAGGATGAGGCCAGTACTCTGCAGCTGCTGAAGAAA[C/T]AGCTGGTGCTCGAGCAGACCATCGAGGACTATGCAGAAACCATCGGCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23377
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078561 Nonsense 448 1177 8 17
Genomic Location (Zv9):
Chromosome 18 (position 44468054)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 46053548
GRCz11 18 46051566
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACATGTTTTCCTCAGGTAAGACAGCTACAGGAGAGCGCAGCACAGCTC[C/T]GAACGGTTTACGCCGGTGAGAAAGCAGAGGCAATTGCCATGCAGGAACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32220
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078561 Essential Splice Site 943 1177 13 17
Genomic Location (Zv9):
Chromosome 18 (position 44453713)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 46039207
GRCz11 18 46037225
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACGTTAGCAGAGATTGTGGAGCAGCTTCAGGAAAGAGAAGCAGCACAG[G/A]TGTGTGGACAGTCTGTTTGTTTCTCTTGTTCAAACTACATTAGGTCACAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link