zgc:173577

Ensembl ID:
ENSDARG00000087593
ZFIN ID:
ZDB-GENE-071004-55
Description:
Zgc:173577 protein [Source:UniProtKB/TrEMBL;Acc:A7MCA4]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16851 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16851
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101550 Nonsense 105 281 2 2
ENSDART00000106448   None 435 None 3
Genomic Location (Zv9):
Chromosome 3 (position 7844554)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 7391263
GRCz11 3 7277103
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTTCAGGGCTGAAGAAACACCTTCGAGTTCATASAGAGGGGAAGCCTTA[T/A]TCWTGCACTGTGTGTGGAAAGASTTTCAGACATGAAGATGGTTTAAGAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link