
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-283f16.1
- Ensembl ID:
- ENSDARG00000087564
- ZFIN ID:
- ZDB-GENE-100922-73
- Human Orthologue:
- NEK11
- Human Description:
- NIMA (never in mitosis gene a)- related kinase 11 [Source:HGNC Symbol;Acc:18593]
- Mouse Orthologue:
- Nek11
- Mouse Description:
- NIMA (never in mitosis gene a)-related expressed kinase 11 Gene [Source:MGI Symbol;Acc:MGI:2442276]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa42792 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa42792
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000128963 | Nonsense | 120 | 604 | 3 | 15 |
ENSDART00000135294 | Nonsense | 120 | 604 | 4 | 16 |
- Genomic Location (Zv9):
- Chromosome 16 (position 43873849)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 41258242 GRCz11 16 41208274 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTGATGTCTCTTTAATTTTCCTCTGTTCCTCAGGACAAAGATCTGGACTG[T/A]AAGCTGGAGGAGCTAAAACACACAGGCAAGACTTTGTCAGAGCCTCAGGT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: