si:dkey-283f16.1

Ensembl ID:
ENSDARG00000087564
ZFIN ID:
ZDB-GENE-100922-73
Human Orthologue:
NEK11
Human Description:
NIMA (never in mitosis gene a)- related kinase 11 [Source:HGNC Symbol;Acc:18593]
Mouse Orthologue:
Nek11
Mouse Description:
NIMA (never in mitosis gene a)-related expressed kinase 11 Gene [Source:MGI Symbol;Acc:MGI:2442276]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42792 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42792
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128963 Nonsense 120 604 3 15
ENSDART00000135294 Nonsense 120 604 4 16
Genomic Location (Zv9):
Chromosome 16 (position 43873849)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 41258242
GRCz11 16 41208274
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGATGTCTCTTTAATTTTCCTCTGTTCCTCAGGACAAAGATCTGGACTG[T/A]AAGCTGGAGGAGCTAAAACACACAGGCAAGACTTTGTCAGAGCCTCAGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link