zgc:85936

Ensembl ID:
ENSDARG00000087529
ZFIN ID:
ZDB-GENE-040426-2450
Description:
hypothetical protein LOC406563 [Source:RefSeq peptide;Acc:NP_999909]
Human Orthologue:
ANKLE1
Human Description:
ankyrin repeat and LEM domain containing 1 [Source:HGNC Symbol;Acc:26812]
Mouse Orthologue:
Ankle1
Mouse Description:
ankyrin repeat and LEM domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1918775]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32264 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32264
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123163 Nonsense 634 927 5 9
Genomic Location (Zv9):
Chromosome 19 (position 49768035)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 48405656
GRCz11 19 48065933
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCTGCAGACGAGCTGGAGCAGTACCTGTACACAGACACAGAGGAGGGC[C/T]AGCAGCTGATCGAGACGCGCGTGCCGCCGACCTGCGCTGACGACACGCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Breast cancer: A locus on 19p13 modifies risk of breast cancer in BRCA1 mutation carriers and is associated with hormone receptor-negative breast cancer in the general population. (View Study)
  • Ovarian cancer: Common variants at 19p13 are associated with susceptibility to ovarian cancer. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link