zgc:171886

Ensembl ID:
ENSDARG00000087514
ZFIN ID:
ZDB-GENE-080204-22
Description:
Zgc:171886 protein [Source:UniProtKB/TrEMBL;Acc:A8KBA3]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa30344 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa30344
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121856 Nonsense 64 466 1 1
Genomic Location (Zv9):
Chromosome Zv9_scaffold3494 (position 155426)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149691.1 77768
GRCz11 KN149691.1 77768
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAACGGCACCACATCACTAGAGGAAAGACGAATTGAAAACAACAACGGA[C/T]AAGTGAGAGAAACAAACACGCCAAACAAAGAGCAATGGGGAAAACAACAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link