zgc:163044

Ensembl ID:
ENSDARG00000087473
ZFIN ID:
ZDB-GENE-070410-128
Description:
hypothetical protein LOC100037354 [Source:RefSeq peptide;Acc:NP_001082977]
Human Orthologue:
DNAJB12
Human Description:
DnaJ (Hsp40) homolog, subfamily B, member 12 [Source:HGNC Symbol;Acc:14891]
Mouse Orthologue:
Dnajb12
Mouse Description:
DnaJ (Hsp40) homolog, subfamily B, member 12 Gene [Source:MGI Symbol;Acc:MGI:1931881]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22181 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22181
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130048 Nonsense 350 369 8 8
Genomic Location (Zv9):
Chromosome 12 (position 49643188)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 48366561
GRCz11 12 48349883
KASP Assay ID:
2260-5797.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTGTACAGGGCGCGGTATTTCGGGGACAGTGAGCTGTACCAGCGAGCC[C/T]AGCGGATGGGGACTCCGAGCTGCTCACGGCTGTCTGAGGTGCAGGCGTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link