wu:fc18f06

Ensembl ID:
ENSDARG00000087467
ZFIN ID:
ZDB-GENE-030131-2816
Description:
Wu:fc18f06 protein [Source:UniProtKB/TrEMBL;Acc:Q503F6]
Human Orthologue:
SLITRK6
Human Description:
SLIT and NTRK-like family, member 6 [Source:HGNC Symbol;Acc:23503]
Mouse Orthologue:
Slitrk6
Mouse Description:
SLIT and NTRK-like family, member 6 Gene [Source:MGI Symbol;Acc:MGI:2443198]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19405 Nonsense Available for shipment Available now
sa32579 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa19405
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121523   None 529 None 2
ENSDART00000128124 Nonsense 695 824 1 2
Genomic Location (Zv9):
Chromosome 1 (position 3428567)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 3726082
GRCz11 1 4152698
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCCCAGCACAAAGAATACGAGCTAGGCGACTACGATAGTGAGAAAGCC[A/T]AGCATATCTGCCACAGTCTTCTTGATAAGGGCAATGAATCCCTGCCCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32579
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121523   None 529 None 2
ENSDART00000128124 Nonsense 734 824 1 2
Genomic Location (Zv9):
Chromosome 1 (position 3428448)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 3726201
GRCz11 1 4152817
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCGACTATCCCGCTGAGTTTGTGGGTTTGGGAGATACCAGTTCCTTGTA[C/A]AAGAGCATCTTAGAAAGGGAGCGGGAACTCCAACAGCTCAGCCTCACCGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder (mania): Genome-wide association study of irritable vs. elated mania suggests genetic differences between clinical subtypes of bipolar disorder. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link