TRPC3

Ensembl ID:
ENSDARG00000087463
Description:
transient receptor potential cation channel, subfamily C, member 3 [Source:HGNC Symbol;Acc:12335]
Human Orthologue:
TRPC3
Human Description:
transient receptor potential cation channel, subfamily C, member 3 [Source:HGNC Symbol;Acc:12335]
Mouse Orthologue:
Trpc3
Mouse Description:
transient receptor potential cation channel, subfamily C, member 3 Gene [Source:MGI Symbol;Acc:MGI:1

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40313 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40313
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123586 Nonsense 60 94 3 3
Genomic Location (Zv9):
Chromosome 4 (position 29590551)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 3358481
GRCz11 14 3465787
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGCAGGTGAGCTGAAGGAGATAAAGCAGGATATCTCCAGTCTGCGGTA[T/A]GAGCTGCTGGAGGAGAAATCTCAGGCCACTGAAGAGCTTTCTCTCCTCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link