wu:fc66f06

Ensembl ID:
ENSDARG00000087421
ZFIN ID:
ZDB-GENE-031118-196
Human Orthologue:
SERBP1
Human Description:
SERPINE1 mRNA binding protein 1 [Source:HGNC Symbol;Acc:17860]
Mouse Orthologue:
Serbp1
Mouse Description:
serpine1 mRNA binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1914120]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19658 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19658
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124032 Nonsense 167 414 3 9
Genomic Location (Zv9):
Chromosome 2 (position 3404556)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 2795438
GRCz11 2 2637337
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAAGCCATCTAGAGGACGTGGAGGAGGACGAGGAATGGGCCGCGGGGGC[C/T]GAGGACGAGGGATGGGACGCGGAGACGGTTTTGATTCCCGGGGGAAACGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link