zgc:100951

Ensembl ID:
ENSDARG00000087412
ZFIN ID:
ZDB-GENE-040801-141
Description:
hypothetical protein LOC445228 [Source:RefSeq peptide;Acc:NP_001003622]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16270 Nonsense Available for shipment Available now
sa23191 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16270
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128372 Nonsense 129 170 2 3
Genomic Location (Zv9):
Chromosome 17 (position 50579835)
Other Location(s):
Assembly Chromosome Position
GRCz11 17 50049525
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
NNACAAATGTGATCAATGYGGCAAAACATTTTTGAGGGCTTCAGAGCTGAAG[A/T]AACATCTCAGAGTTCACACAAAGGAGAAACCGTATTCCTGTTCTGAGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23191
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128372 Nonsense 153 170 3 3
Genomic Location (Zv9):
Chromosome 17 (position 50579761)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAAACCGTATTCCTGTTCTGAGTGTGGAAAGAGTTTTACTCAGCAGAC[A/T]AATTTAAGAACACATCAGAAGATCCACACTGGTGTGAAAGAGTATCTGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link