tpm1

Ensembl ID:
ENSDARG00000087402
ZFIN IDs:
ZDB-GENE-040426-854, ZDB-GENE-040426-854, ZDB-GENE-070822-17
Description:
hypothetical protein LOC100124602 [Source:RefSeq peptide;Acc:NP_001096099]
Human Orthologue:
TPM1
Human Description:
tropomyosin 1 (alpha) [Source:HGNC Symbol;Acc:12010]
Mouse Orthologue:
Tpm1
Mouse Description:
tropomyosin 1, alpha Gene [Source:MGI Symbol;Acc:MGI:98809]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44342 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44342
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014851   None 327 None 10
ENSDART00000121680   None 284 None 9
ENSDART00000125892   None 284 None 10
ENSDART00000131098 Nonsense 154 247 5 8
Genomic Location (Zv9):
Chromosome 25 (position 33913627)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 32742360
GRCz11 25 33227787
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGCGGCTGGCGTTTGGAATGGCCTTCTCCCTACACTAACAGATGCAAT[C/T]GAAGATTACAAGATGAGCTTCGGGTGTTGGACCAAACCTATAAGTCATTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link