Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
tpm1
- Ensembl ID:
- ENSDARG00000087402
- ZFIN IDs:
- ZDB-GENE-040426-854, ZDB-GENE-040426-854, ZDB-GENE-070822-17
- Description:
- hypothetical protein LOC100124602 [Source:RefSeq peptide;Acc:NP_001096099]
- Human Orthologue:
- TPM1
- Human Description:
- tropomyosin 1 (alpha) [Source:HGNC Symbol;Acc:12010]
- Mouse Orthologue:
- Tpm1
- Mouse Description:
- tropomyosin 1, alpha Gene [Source:MGI Symbol;Acc:MGI:98809]
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa44342 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa44342
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000014851 | None | 327 | None | 10 | |
| ENSDART00000121680 | None | 284 | None | 9 | |
| ENSDART00000125892 | None | 284 | None | 10 | |
| ENSDART00000131098 | Nonsense | 154 | 247 | 5 | 8 |
- Genomic Location (Zv9):
- Chromosome 25 (position 33913627)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 32742360 GRCz11 25 33227787 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CATGCGGCTGGCGTTTGGAATGGCCTTCTCCCTACACTAACAGATGCAAT[C/T]GAAGATTACAAGATGAGCTTCGGGTGTTGGACCAAACCTATAAGTCATTA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Mean platelet volume: A genome-wide meta-analysis identifies 22 loci associated with eight hematological parameters in the HaemGen consortium. (View Study)
- Orofacial clefts: Genome-wide meta-analyses of nonsyndromic cleft lip with or without cleft palate identify six new risk loci. (View Study)
- Platelet counts: New gene functions in megakaryopoiesis and platelet formation. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
