zgc:66473

Ensembl ID:
ENSDARG00000087375
ZFIN ID:
ZDB-GENE-030131-5708
Description:
hypothetical protein LOC327497 [Source:RefSeq peptide;Acc:NP_956108]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7056 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa7056
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129312 Essential Splice Site 4 398 1 2
Genomic Location (Zv9):
Chromosome 7 (position 3046060)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 2622117
GRCz11 7 2430179
KASP Assay ID:
554-4833.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTSCTGTGAGGTGGACAGATTTAATCCAGAGATCACCATGGATTCAAGG[T/A]GAGTTTTTTTCTTGATTTAGTTTTGTTAAATTTTGCTCCAGATAGCATCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link