LOC556023

Ensembl ID:
ENSDARG00000087352
Human Orthologue:
DNAH2
Human Description:
dynein, axonemal, heavy chain 2 [Source:HGNC Symbol;Acc:2948]
Mouse Orthologue:
Dnahc2
Mouse Description:
dynein, axonemal, heavy chain 2 Gene [Source:MGI Symbol;Acc:MGI:107731]

Alleles

There are 15 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20913 Nonsense Available for shipment Available now
sa9429 Nonsense Available for shipment Available now
sa8974 Nonsense Mutation detected in F1 DNA During 2018
sa18660 Nonsense Available for shipment Available now
sa40870 Essential Splice Site Mutation detected in F1 DNA During 2018
sa14972 Essential Splice Site Available for shipment Available now
sa44656 Essential Splice Site Mutation detected in F1 DNA During 2018
sa17948 Nonsense Available for shipment Available now
sa18040 Nonsense Available for shipment Available now
sa5407 Essential Splice Site F2 line generated During 2018
sa26937 Essential Splice Site Mutation detected in F1 DNA During 2018
sa16702 Nonsense Available for shipment Available now
sa40871 Nonsense Mutation detected in F1 DNA During 2018
sa34048 Essential Splice Site Available for shipment Available now
sa34049 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa20913
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128014 Nonsense 301 4506 6 87
Genomic Location (Zv9):
Chromosome 7 (position 22513733)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 21078918
GRCz11 7 21345256
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTGGACAGCATTAGTACGCAGCTCCAAAAACCTGGAGTCCGTCATATA[C/T]AGGAAATTCTGCAGCTCTACACATCAACCTACATCCCACCCTTCTGTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9429
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128014 Nonsense 790 4506 15 87
Genomic Location (Zv9):
Chromosome 7 (position 22562718)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 21127903
GRCz11 7 21394241
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTGTTTTCTGAGAGAATTCGCTTCYTGGATAAGAAAATTCAACCAGGCT[T/A]GTCGAAACTGCATTGRTCTACTAAAGGAACACCCAGCGCCTTTATCAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8974
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128014 Nonsense 795 4506 15 87
Genomic Location (Zv9):
Chromosome 7 (position 22562734)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 21127919
GRCz11 7 21394257
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTCGCTTCYTGGATAAGAAAATTCAACCAGGCTWGTCGAAACTGCATTG[G/A]TCTACTAAAGGAACACCCAGCGCCTTTATCAATGACTGTAGAGTTCACGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18660
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128014 Nonsense 902 4506 17 87
Genomic Location (Zv9):
Chromosome 7 (position 22572417)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 21137602
GRCz11 7 21403940
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTCAGCATGTCTGTGTGTGTTTTCAGGTGCAACAGCACTGGACGTCATA[C/A]ATGGAGAAGATAGACCARATGCTTGAAGAGGCGTTTCKTGTGAATATAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40870
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128014 Essential Splice Site 1444 4506 26 87
Genomic Location (Zv9):
Chromosome 7 (position 22598061)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 21163246
GRCz11 7 21429584
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCAGTGACATTTCAGGAGCGGCCAGCAAAGAGCTCTCCATAGAACAGG[T/A]ATGAAATGCTTTAGATGATACGATACCCTTTTCTCGCTTTCCTATTTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14972
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128014 Essential Splice Site 1684 4506 31 87
Genomic Location (Zv9):
Chromosome 7 (position 22639050)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 21204235
GRCz11 7 21470573
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGAGTTTGTTGACTTCACTCATCCTGTTCTTCTGGAGGGGCCAGTGGAG[G/A]TGGGTTTCAAACCTACATTACTTYAACAGCCTTTCTTGACGAAWGCACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44656
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128014 Essential Splice Site 1726 4506 32 87
Genomic Location (Zv9):
Chromosome 7 (position 22639262)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 21204447
GRCz11 7 21470785
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGATGCCAGGGAAAAGGGGCAAATGGGTGCGAGACTGGCCAGGACAGG[T/C]GAGTGTCTGCGTGTGTGTTAGTCTGTTTGCATGCCTGTGTTTGTGTATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17948
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128014 Nonsense 1948 4506 37 87
Genomic Location (Zv9):
Chromosome 7 (position 22650351)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 21215536
GRCz11 7 21481874
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGAKGAGTTTAACCGTATAAACATTGAGGTGCTGTCCGTGGTGGCTCAG[C/T]AGATTCTGTCGATCCTGTCTGCTCTGTCTGCGGGACTCAATAATTTCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18040
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128014 Nonsense 2175 4506 41 87
Genomic Location (Zv9):
Chromosome 7 (position 22669999)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 21235184
GRCz11 7 21501522
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATTGTAGGAAAGACGGGCAGCGGCAAAACGGTCACATGGAGAACCCTT[C/T]AGAACACCCTCAGCACCTTGCACCGCAATGGAGAACCAGGATTCAACCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5407
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128014 Essential Splice Site 2526 4506 49 87
Genomic Location (Zv9):
Chromosome 7 (position 22700029)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 21265214
GRCz11 7 21531552
KASP Assay ID:
554-3586.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACATTCAAATGTTCTTATGTTCATATGTCCNTTTTTTCTGTGTTTATTTC[A/T]GACTAGCTCTAATAACGTGCAGGAGATCATTGAGTCTCGGGTGGAAAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26937
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128014 Essential Splice Site 2600 4506 49 87
Genomic Location (Zv9):
Chromosome 7 (position 22700256)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 21265441
GRCz11 7 21531779
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTACGGCTTTTGGTATGACCGTCAGAAACAGACCCTCAAATACATCAAG[G/T]TAAGACTGTGTGTGTGTGTGTGTGGTAATGGGCATTCATTACCTTTTGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16702
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128014 Nonsense 3025 4506 59 87
Genomic Location (Zv9):
Chromosome 7 (position 22729164)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 21294349
GRCz11 7 21560687
KASP Assay ID:
2259-8708.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAGGCTGCCACTTCATATCATTTCTCTGGTGGCTTCACAGATCCAGACY[A/T]AAGTTGCCAGTATCTTCGTCACCGTGCACCAGTCTGTGGCCCAGTTCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40871
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128014 Nonsense 3253 4506 63 87
Genomic Location (Zv9):
Chromosome 7 (position 22733637)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 21298822
GRCz11 7 21565160
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATAAGGACAACATCTCTGACCGTGTGCTGAAGACCATTGGACAGTACTG[C/A]ACACAGCCTGACTTCCAGCCCGAGATCATCGGACGTGTCTCACTTGCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34048
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128014 Essential Splice Site 3749 4506 73 87
Genomic Location (Zv9):
Chromosome 7 (position 22747578)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 21312763
GRCz11 7 21579101
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGAGGATAAACAATCTCAACAGACACCACACTTATGCTGTCTACAGG[T/A]CTGAAACGCTAACTCACACATGCATAGATTTTGTGTTTAGGGGTGAAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34049
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128014 Nonsense 4268 4506 82 87
Genomic Location (Zv9):
Chromosome 7 (position 22776793)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 21341978
GRCz11 7 21608316
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCACTAGGAAGTTGCTAAAGGATGATCTTTCACCTCTGAATGTGGTTT[T/A]GCTGCAGGAGATCCAGAGATACAACACACTGCTGCACACCATCAGGTCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link