
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ENSDARG00000087345
- Ensembl ID:
- ENSDARG00000087345
- Mouse Orthologue:
- 4933428M09Rik
- Mouse Description:
- RIKEN cDNA 4933428M09 gene Gene [Source:MGI Symbol;Acc:MGI:1918498]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa13193 | Essential Splice Site | Available for shipment | Available now |
sa19624 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa13193
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000110690 | Essential Splice Site | 127 | 733 | 2 | 3 |
- Genomic Location (Zv9):
- Chromosome 1 (position 57210560)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 55994393 GRCz11 1 56664499 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GATGATGATAAGRWAGAAGATAAAGTACATACAGRGGACACGATCTCTGG[T/C]AAGTGRATATGTACATGCAAATRATTGAACAAAGTATTTTGTTTAATTAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa19624
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000110690 | Nonsense | 219 | 733 | 3 | 3 |
- Genomic Location (Zv9):
- Chromosome 1 (position 57208554)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 55992387 GRCz11 1 56662389 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAGTCTCTGTAGCTGACGCAAATGTTATGATGTCTAAAACCCAGATGAAT[C/T]AAACAGAGAAAGAAGCTGCAGCAGCTGACAAAAATGGTACCGTGTCTAAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: