
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ctsa
- Ensembl ID:
- ENSDARG00000087307
- ZFIN ID:
- ZDB-GENE-030131-537
- Description:
- lysosomal protective protein [Source:RefSeq peptide;Acc:NP_956844]
- Human Orthologue:
- CTSA
- Human Description:
- cathepsin A [Source:HGNC Symbol;Acc:9251]
- Mouse Orthologue:
- Ctsa
- Mouse Description:
- cathepsin A Gene [Source:MGI Symbol;Acc:MGI:97748]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa14856 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa14856
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000123867 | Nonsense | 356 | 379 | 10 | 10 |
- Genomic Location (Zv9):
- Chromosome 6 (position 55292226)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 55399923 GRCz11 6 55409826 - KASP Assay ID:
- 1641-0480.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCTGCGCTTCACATCTCTCCTAATGCTCTGGACTGGGTCATCTGCAGGTA[C/A]ACCGACTGCACTTTAGTTGCCAGGAGGTTGTTATCACARAATAAAACCGG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: