TMEM182 (2 of 2)

Ensembl ID:
ENSDARG00000087285
Description:
transmembrane protein 182 [Source:HGNC Symbol;Acc:26391]
Human Orthologue:
TMEM182
Human Description:
transmembrane protein 182 [Source:HGNC Symbol;Acc:26391]
Mouse Orthologue:
Tmem182
Mouse Description:
transmembrane protein 182 Gene [Source:MGI Symbol;Acc:MGI:1923725]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40657 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40657
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129491 Nonsense 102 257 3 5
Genomic Location (Zv9):
Chromosome 6 (position 14217813)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 14177775
GRCz11 6 14307212
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTTTCCACCAGCTAATCTGCCATCCCAGAAACTTTGTGTCCCAGCCTA[C/A]TTGTCTCATGCTCCCAGTTCAGGACATCTCAACAGCATTCAAACCTCAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link