zgc:63568

Ensembl ID:
ENSDARG00000087262
ZFIN ID:
ZDB-GENE-040426-1165
Description:
hypothetical protein LOC393427 [Source:RefSeq peptide;Acc:NP_956749]
Human Orthologues:
ADH1A, ADH1B, ADH4, ADH6, ADH7
Human Descriptions:
alcohol dehydrogenase 1A (class I), alpha polypeptide [Source:HGNC Symbol;Acc:249]
alcohol dehydrogenase 1B (class I), beta polypeptide [Source:HGNC Symbol;Acc:250]
alcohol dehydrogenase 4 (class II), pi polypeptide [Source:HGNC Symbol;Acc:252]
alcohol dehydrogenase 6 (class V) [Source:HGNC Symbol;Acc:255]
alcohol dehydrogenase 7 (class IV), mu or sigma polypeptide [Source:HGNC Symbol;Acc:256]
Mouse Orthologues:
AC079845.1, Adh1, Adh4, Adh6a, Adh6b, Adh7
Mouse Descriptions:
alcohol dehydrogenase 1 (class I) Gene [Source:MGI Symbol;Acc:MGI:87921]
alcohol dehydrogenase 4 (class II), pi polypeptide Gene [Source:MGI Symbol;Acc:MGI:1349472]
alcohol dehydrogenase 6 (class V), pseudogene 1 (Adh6-ps1), non-coding RNA [Source:RefSeq DNA;Acc:NR
alcohol dehydrogenase 6A (class V) Gene [Source:MGI Symbol;Acc:MGI:1916367]
alcohol dehydrogenase 6B (class V) Gene [Source:MGI Symbol;Acc:MGI:2446626]
alcohol dehydrogenase 7 (class IV), mu or sigma polypeptide Gene [Source:MGI Symbol;Acc:MGI:87926]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11240 Nonsense Available for shipment Available now
sa2759 Essential Splice Site F2 line generated During 2018

Mutation Details

Allele Name:
sa11240
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027892 Nonsense 136 377 6 10
ENSDART00000135079 Nonsense 139 380 6 10
Genomic Location (Zv9):
Chromosome 14 (position 37115967)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 35555294
GRCz11 14 35895608
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAAAACTCAACAAGGTGTTCTTGCTGATGGCACCAGCAGGATCACCTG[T/A]AAGAATCAGCAGGTTCATCAGTTTATTGGTATCAGCACTTTCTCTGAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2759
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027892 Essential Splice Site 370 377 9 10
ENSDART00000135079 Essential Splice Site 373 380 9 10
Genomic Location (Zv9):
Chromosome 14 (position 37118206)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 35557533
GRCz11 14 35897847
KASP Assay ID:
554-3005.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTAGATCAGATTAACCAGGCATTTGATCTCATYRTGAGTGGGAAAAGG[T/C]TTGTTTTTATGCATCTACTGTACTTATGAACAAAATCCTTGATTTGTATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link