zgc:152954

Ensembl ID:
ENSDARG00000087226
ZFIN ID:
ZDB-GENE-060929-1262
Description:
kelch repeat and BTB domain-containing protein 2 [Source:RefSeq peptide;Acc:NP_001070628]
Human Orthologue:
KBTBD2
Human Description:
kelch repeat and BTB (POZ) domain containing 2 [Source:HGNC Symbol;Acc:21751]
Mouse Orthologue:
Kbtbd2
Mouse Description:
kelch repeat and BTB (POZ) domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2384811]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41988 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41988
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123741 Nonsense 167 631 4 4
Genomic Location (Zv9):
Chromosome 12 (position 15267121)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 14122774
GRCz11 12 14161077
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAAAGTGCTAAACGCATGGTAGAGCACAAATTTCCTGTTGTCTACCGA[C/T]AGGAGGCTTTTCTGCAACTCTCGCATGAGCTACTACTGGACCTCCTGAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link