ENSDARG00000087197

Ensembl ID:
ENSDARG00000087197

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45597 Nonsense Mutation detected in F1 DNA During 2018
sa11486 Nonsense Available for shipment Available now
sa8890 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45597
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130160 Nonsense 19 275 1 3
Genomic Location (Zv9):
Chromosome 17 (position 15108084)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 15258912
GRCz11 17 15266845
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTGAGCACTGGGATATATCGCAGTCCTCTTCCAGACGTCTCTAGCCAA[C/T]AACAAGAGATAAGTCACATCATTAAAATGCCTTCTGTCTCCAACTTTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11486
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130160 Nonsense 45 275 1 3
ENSDART00000130160 Nonsense 45 275 1 3
Genomic Location (Zv9):
Chromosome 17 (position 15108004)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 15258832
GRCz11 17 15266765
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTTCTGTCTCCAACTTTGTGGTCAGTTTTCCTAATAAGAGAMTTGTYTA[T/A]CATGASAGAAGTGATCAAACGCTYAACGCCACATCKCTGGATGGATTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8890
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130160 Nonsense 45 275 1 3
ENSDART00000130160 Nonsense 45 275 1 3
Genomic Location (Zv9):
Chromosome 17 (position 15108004)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 15258832
GRCz11 17 15266765
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTTCTGTCTCCAACTTTGTGGTCAGTTTTCCTAATAAGAGAMTTGTYTA[T/A]CATGASAGAAGTGATCAAACGCTYAACGCCACATCKCTGGATGGATTATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link