zgc:77060

Ensembl ID:
ENSDARG00000087188
ZFIN ID:
ZDB-GENE-040704-63
Description:
E4 binding protein 4-6 [Source:RefSeq peptide;Acc:NP_001002218]
Human Orthologue:
NFIL3
Human Description:
nuclear factor, interleukin 3 regulated [Source:HGNC Symbol;Acc:7787]
Mouse Orthologue:
Nfil3
Mouse Description:
nuclear factor, interleukin 3, regulated Gene [Source:MGI Symbol;Acc:MGI:109495]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9374 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa9374
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127604 Nonsense 91 350 2 2
Genomic Location (Zv9):
Chromosome 3 (position 13893382)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 13951669
GRCz11 3 14101515
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ARCGCCGTGTAAATGACATGGTGTTAGAAAACCGTGTCCTAACGTTACTC[G/T]AGGAGAACGCTAGACTGCGAGCAGAACTTCTAGCACTGAAATTCCGCTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link